Sequence ID | >WENV170704846 |
Genome ID | LLEN01003603 |
Phylum/Class | [LLEN] bioreactor metagenome; day86 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 330 |
End posion on genome | 414 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
ttagtattgc |
tRNA gene sequence |
GCGGTTGTGGCGGAATTGGTAGACGCGCCAGCTTGAGGGGCTGGTGACTTAGGTCGTGGG |
Downstream region at tRNA end position |
ctaaattaaa |
Secondary structure (Cloverleaf model) | >WENV170704846 Leu GAG c ACCA ctaaattaaa G - C C - G G - C G - C T - A T - A G - C T G T C C C C C A T A A G | | | | | A T G G C G G G G G G C G | | | T T G A C G C T A G G TGACTTAGGTCGT C - G C - G A - T G - C C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |