Sequence ID | >WENV170704854 |
Genome ID | LLEN01004193 |
Phylum/Class | [LLEN] bioreactor metagenome; day86 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 389 |
End posion on genome | 473 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ttgaaataat |
tRNA gene sequence |
GCGGGTTTGGCGGAATTGGTAGACGCGCTGGATTTAGGTTCCAGTATCGCAAGATGTGAG |
Downstream region at tRNA end position |
tttcaaagca |
Secondary structure (Cloverleaf model) | >WENV170704854 Leu TAG t ACCA tttcaaagca G + T C - G G - C G - C G - C T - A T + G T G T T T C T C A T A A G + | | | | A T G G C G G A G A G C G | | | T T G A C G C T A G G TATCGCAAGATGT C - G T - A G - C G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |