Sequence ID | >WENV170704855 |
Genome ID | LLEN01004193 |
Phylum/Class | [LLEN] bioreactor metagenome; day86 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 518 |
End posion on genome | 590 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
aatacattgc |
tRNA gene sequence |
AGGGATATAGCCAAGCGGTAAGGCAGCGGGTTTTGATCCCGTCATTCAGAGGTTCAAATC |
Downstream region at tRNA end position |
tttatttaat |
Secondary structure (Cloverleaf model) | >WENV170704855 Gln TTG c GCat tttatttaat A - T G - C G - C G - C A - T T - A A - T T A T T C T C C A G A A | | | | | A C A C C G A G A G G C G | | | T T G A G G C T A A CATTC G + T C - G G - C G - C G - C T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |