Sequence ID | >WENV170704864 |
Genome ID | LLEN01004953 |
Phylum/Class | [LLEN] bioreactor metagenome; day86 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 410 |
End posion on genome | 483 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
tttttgttta |
tRNA gene sequence |
GGCCGGGTGGCAGAGTGGTCATGCAGCGGATTGCAAATCCGTCAACGCCGGTTCGATTCC |
Downstream region at tRNA end position |
atttaaaagc |
Secondary structure (Cloverleaf model) | >WENV170704864 Cys GCA a TCCA atttaaaagc G - C G - C C - G C - G G - C G + T G - C T T T C A G C C A G A G | | | | G T G A C G G C C G G C G | | | T T G A T G C T C A CAAC G + T C - G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |