Sequence ID | >WENV170704876 |
Genome ID | LLEN01007845 |
Phylum/Class | [LLEN] bioreactor metagenome; day86 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 99 |
End posion on genome | 185 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
accaaatagt |
tRNA gene sequence |
GCGAGTGTGGCGGAATAGGTAGACGCGTTGGACTTAAAATCCAATTCCGGTTTCGGAGTG |
Downstream region at tRNA end position |
cttttataca |
Secondary structure (Cloverleaf model) | >WENV170704876 Leu TAA t ACCA cttttataca G - C C - G G - C A - T G + T T + G G - C T T T C A G C C A T A A G | | | | | G A G G C G G T C G G C G | | | T T G A C G C T A G G TTCCGGTTTCGGAGT T - A T - A G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |