Sequence ID | >WENV170704877 |
Genome ID | LLEN01007845 |
Phylum/Class | [LLEN] bioreactor metagenome; day86 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 215 |
End posion on genome | 303 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ttttatagct |
tRNA gene sequence |
AGAGGGTTGCCAGAGTTGGTCGAATGGACCGGTTTTGAAAACCGGCGAGGTTCACGCCTC |
Downstream region at tRNA end position |
ttatttaaaa |
Secondary structure (Cloverleaf model) | >WENV170704877 Ser TGA t GCCA ttatttaaaa A - T G - C A - T G - C G + T G - C T - A T A T C C C C C A T T G A G | | | | | G G G A C C G G G G G C G | | | T T T A T G G C G A A CGAGGTTCACGCCTCC C - G C - G G - C G - C T - A T A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |