Sequence ID | >WENV170704891 |
Genome ID | LLEN01009771 |
Phylum/Class | [LLEN] bioreactor metagenome; day86 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 8 |
End posion on genome | 97 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
nnngagatgc |
tRNA gene sequence |
GGTGAAGTGTCCGAGTGGCTGAAGGAGCTCGCCTGGAAAGCGTGTATACGAGTGATCGTA |
Downstream region at tRNA end position |
gcttccataa |
Secondary structure (Cloverleaf model) | >WENV170704891 Ser GGA c GCCA gcttccataa G - C G - C T - A G - C A - T A - T G - C T A T C A C C C A T G A G | | | | | G G G C C T G T G G G C G | | | T T C A G G A T G A G TATACGAGTGATCGTATC C - G T T C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |