Sequence ID | >WENV170704911 |
Genome ID | LLEN01013896 |
Phylum/Class | [LLEN] bioreactor metagenome; day86 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 45 |
End posion on genome | 132 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
ttaaatattg |
tRNA gene sequence |
GGAGAGTTGCCAGAGTGGTTAATGGAGCAGTTTGCTAAACTGTCGACGGGTAACTGTCGC |
Downstream region at tRNA end position |
ttttatagat |
Secondary structure (Cloverleaf model) | >WENV170704911 Ser GCT g GCAA ttttatagat G - C G - C A - T G - C A - T G - C T - A T A T C A C C C A T G A G | | | | | G G G A C C G T G G G C G | | | T T T A T G G T A A CGACGGGTAACTGTCGC G + T C - G A - T G - C T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |