Sequence ID | >WENV170704932 |
Genome ID | LLEN01018399 |
Phylum/Class | [LLEN] bioreactor metagenome; day86 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 103 |
End posion on genome | 189 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
gataccacgt |
tRNA gene sequence |
GCGGTGGTGGCGGAATTGGTAGACGCGCTAGCTTCAGGTGCTAGTGTCCGCAAGGACGTG |
Downstream region at tRNA end position |
aaatttaaag |
Secondary structure (Cloverleaf model) | >WENV170704932 Leu CAG t ACCA aaatttaaag G - C C - G G - C G - C T T G - C G - C T G T C T C C C A T A A G | | | | | A T G G C G G A G G G C G | | | T T G A C G C T A G G TGTCCGCAAGGACGT C - G T - A A - T G - C C - G T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |