Sequence ID | >WENV170704945 |
Genome ID | LLEO01000009 |
Phylum/Class | [LLEO] bioreactor metagenome; day35 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 30520 |
End posion on genome | 30435 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
accaaacagt |
tRNA gene sequence |
GCCCAAGTGGCGGAATGGTAGACGCAGGGGATTCAAAATCCCCCGCCTTCACGGGCGTGT |
Downstream region at tRNA end position |
cataccgccg |
Secondary structure (Cloverleaf model) | >WENV170704945 Leu CAA t ACCA cataccgccg G - C C - G C - G C - G A - T A - T G - C T G T C A C C C A T A A G | | | | | G G G G C G G T G G G C G | | | T T T A C G C A G A CGCCTTCACGGGCGT G - C G - C G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |