Sequence ID | >WENV170704962 |
Genome ID | LLEO01000044 |
Phylum/Class | [LLEO] bioreactor metagenome; day35 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 7167 |
End posion on genome | 7093 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
tgttccggac |
tRNA gene sequence |
GCGGGCGTAGCTCAGTGGTAGAGCACAACCTTGCCAAGGTTGGGGTCGTGAGTTCGAATC |
Downstream region at tRNA end position |
attattcggc |
Secondary structure (Cloverleaf model) | >WENV170704962 Gly GCC c TCCA attattcggc G - C C - G G - C G - C G - C C - G G - C T A T T A C T C A G A A + | | | | G T C T C G G T G A G C G | | | | T T G G A G C T A A GGGTC C - G A - T A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |