Sequence ID | >WENV170704964 |
Genome ID | LLEO01000071 |
Phylum/Class | [LLEO] bioreactor metagenome; day35 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 7929 |
End posion on genome | 8003 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
acgataggac |
tRNA gene sequence |
GCTGTGGTAGCTCAGTGGTAGAGCGCACCCTTGGTAAGGGTGAGGTCGGGAGTTCAATCC |
Downstream region at tRNA end position |
tcgtaaactt |
Secondary structure (Cloverleaf model) | >WENV170704964 Thr GGT c ACCA tcgtaaactt G - C C - G T - A G - C T - A G - C G + T C T T C C C T C A G A A | | | | | A T C T C G G G G A G C G | | | | T T G G A G C T A G AGGTC C - G A - T C - G C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |