Sequence ID | >WENV170704973 |
Genome ID | LLEO01000120 |
Phylum/Class | [LLEO] bioreactor metagenome; day35 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 5488 |
End posion on genome | 5562 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
cgcgcacggt |
tRNA gene sequence |
TGGGGTGTAGCCAAGTGGTAAGGCAACTGTTTTTGGTACAGTGTACCGTAGGTTCGAATC |
Downstream region at tRNA end position |
atcattcccg |
Secondary structure (Cloverleaf model) | >WENV170704973 Gln TTG t GCCA atcattcccg T - A G - C G - C G - C G - C T - A G - C T A T C A T C C A G A A | | | | | G T A C C G G T A G G C G | | | T T G A G G C T A A GTACC A - T C - G T - A G - C T - A T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |