Sequence ID | >WENV170704980 |
Genome ID | LLEO01000192 |
Phylum/Class | [LLEO] bioreactor metagenome; day35 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 1902 |
End posion on genome | 1976 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
acgaacatac |
tRNA gene sequence |
TGGGGCGTGGCCAAGTGGTAAGGCAGCGGTTTTTGGTATCGCCATTCGCAGGTTCGAATC |
Downstream region at tRNA end position |
tcattttcca |
Secondary structure (Cloverleaf model) | >WENV170704980 Gln TTG c GCCA tcattttcca T - A G - C G - C G - C G - C C - G G - C T A T C G T C C A G A G | | | | | G T A C C G G C A G G C G | | | T T G A G G C T A A CATTC G - C C - G G - C G + T T - A T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |