Sequence ID | >WENV170704981 |
Genome ID | LLEO01000197 |
Phylum/Class | [LLEO] bioreactor metagenome; day35 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 2281 |
End posion on genome | 2367 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
acctaaagct |
tRNA gene sequence |
GCGGACGTGGTGAAATTGGTAAACACAAGGGACTTAAAATCCCTCGCCCTAACCGGCTTA |
Downstream region at tRNA end position |
aatgcttttt |
Secondary structure (Cloverleaf model) | >WENV170704981 Leu TAA t ACCA aatgcttttt G - C C - G G - C G - C A - T C - G G - C T G T T G C C C A T A A G | | | | | A T A G T G A C G G G C G | | | T T G A C A C T A A A CGCCCTAACCGGCTT A - T G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |