Sequence ID | >WENV170704985 |
Genome ID | LLEO01000225 |
Phylum/Class | [LLEO] bioreactor metagenome; day35 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 5904 |
End posion on genome | 5830 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
ggcaaaggat |
tRNA gene sequence |
GGGCGTGTAGCTCAGCGGGAGAGCACTACGTTGACATCGTAGGGGTCACTGGTTCAATCC |
Downstream region at tRNA end position |
ttcttttctt |
Secondary structure (Cloverleaf model) | >WENV170704985 Val GAC t ACCA ttcttttctt G - C G - C G - C C - G G - C T - A G - C C T T T G A C C A G A A | | | | | A C C T C G A C T G G C G | | | | T T G G A G C G A A GGGTC C - G T - A A - T C - G G - C T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |