Sequence ID | >WENV170705011 |
Genome ID | LLEO01000954 |
Phylum/Class | [LLEO] bioreactor metagenome; day35 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 636 |
End posion on genome | 711 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
ccatttataT |
tRNA gene sequence |
GGGGCCTTAGCTCAGTTGGTAGAGCGCCTGCTTTGCAAGCAGGATGTCAGGAGTTCGAAT |
Downstream region at tRNA end position |
taccttcctg |
Secondary structure (Cloverleaf model) | >WENV170705011 Ala TGC T CCAt taccttcctg G A G - C G - C G + T C C C - G T - A T A T T C C T C A T G A A | | | | | G T C T C G A G G A G C G | | | | T T G G A G C T A G ATGTC C - G C - G T - A G - C C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |