Sequence ID | >WENV170705052 |
Genome ID | LLEP01000001 |
Phylum/Class | [LLEP] bioreactor metagenome; day64 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 212492 |
End posion on genome | 212568 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aatttgggtt |
tRNA gene sequence |
GGGCCTGTAGCTCAGTTGGTTAGAGCCGACCGCTCATAACGGTCTGGTCGTAGGTTCGAG |
Downstream region at tRNA end position |
ttttatcttg |
Secondary structure (Cloverleaf model) | >WENV170705052 Met CAT t ACCA ttttatcttg G - C G - C G - C C - G C - G T + G G - C T G T C A T C C A T G A A | | | | | G T C T C G G T A G G C G | | | | T T G G A G C T T A C TGGTC G - C A - T C - G C - G G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |