Sequence ID | >WENV170705054 |
Genome ID | LLEP01000005 |
Phylum/Class | [LLEP] bioreactor metagenome; day64 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 15152 |
End posion on genome | 15227 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
cgaacacaat |
tRNA gene sequence |
GTGCCCGTAGCTCAGCTGGTAGAGCATCCGACTTTTAATCGGACGGTCGAAGGTTCGAAT |
Downstream region at tRNA end position |
atctttccaa |
Secondary structure (Cloverleaf model) | >WENV170705054 Lys TTT t ACCA atctttccaa G - C T - A G - C C - G C - G C - G G - C T A T C T T C C A C G A A | | | | | G T C T C G G A A G G C G | | | | T T G G A G C T A A CGGTC T - A C - G C - G G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |