Sequence ID | >WENV170705055 |
Genome ID | LLEP01000005 |
Phylum/Class | [LLEP] bioreactor metagenome; day64 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 70164 |
End posion on genome | 70237 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
cttcaaatga |
tRNA gene sequence |
GGCCACGTGGCGGAGTGGTGACGCAGCGGATTGCAAATCCGTGTACCCCGGTTCGATTCC |
Downstream region at tRNA end position |
aaattcccga |
Secondary structure (Cloverleaf model) | >WENV170705055 Cys GCA a TCCA aaattcccga G - C G - C C - G C - G A - T C - G G - C T T T G G G C C A G A G | | | | | G T G G C G C C C G G C G | | | T T G A C G C T G A GTAC G + T C - G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |