Sequence ID | >WENV170705056 |
Genome ID | LLEP01000005 |
Phylum/Class | [LLEP] bioreactor metagenome; day64 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 71063 |
End posion on genome | 71138 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
cacatcgtga |
tRNA gene sequence |
TCCCCGGTAGCTCAGTTGGTAGAGCGAGCGGCTGTTAACCGCTTTGTCGCAAGTTCGAGT |
Downstream region at tRNA end position |
cttttcctaa |
Secondary structure (Cloverleaf model) | >WENV170705056 Asn GTT a GCCA cttttcctaa T - A C - G C - G C - G C - G G - C G - C T G T C G T T C A T G A A | | | | | G T C T C G G C A A G C G | | | | T T G G A G C T A G TTGTC A - T G - C C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |