Sequence ID | >WENV170705063 |
Genome ID | LLEP01000006 |
Phylum/Class | [LLEP] bioreactor metagenome; day64 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 144741 |
End posion on genome | 144665 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
ttgcgcccgt |
tRNA gene sequence |
GGTCCCGTAGCTCAGCAGGATAGAGCACCAGATTCCTAATCTGGGGGTCGCGCGTTCGAA |
Downstream region at tRNA end position |
gcgcatccgg |
Secondary structure (Cloverleaf model) | >WENV170705063 Arg CCT t ACCA gcgcatccgg G - C G + T T - A C - G C - G C - G G - C T A T C G C G C A C G A A | | | | | G A C T C G G C G C G C G | | | | T T G G A G C A T A A GGGTC C - G C - G A - T G - C A - T T A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |