Sequence ID | >WENV170705064 |
Genome ID | LLEP01000007 |
Phylum/Class | [LLEP] bioreactor metagenome; day64 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 10585 |
End posion on genome | 10661 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cgacatttga |
tRNA gene sequence |
CGCGGGGTGGAGCAGCCCGGTAGCTCGTCAGGCTCATAACCTGAAGGTCGTAGGTTCAAA |
Downstream region at tRNA end position |
attttcctta |
Secondary structure (Cloverleaf model) | >WENV170705064 Met CAT a ACCA attttcctta C A G - C C - G G - C G - C G - C G - C T A T C A T C C A C G A G | | | | | A C C G A G G T A G G C C | | | | T T G G C T C G T A G AGGTC T - A C - G A - T G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |