Sequence ID | >WENV170705068 |
Genome ID | LLEP01000008 |
Phylum/Class | [LLEP] bioreactor metagenome; day64 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 142238 |
End posion on genome | 142313 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
ccaaacgggg |
tRNA gene sequence |
GGGCGGTTAGCTCAGTTGGTAGAGCGCTTCGTTTACACCGAAGATGTCGGGAGTTCGAGT |
Downstream region at tRNA end position |
ttttggttct |
Secondary structure (Cloverleaf model) | >WENV170705068 Val TAC g ACCA ttttggttct G - C G - C G - C C - G G - C G - C T - A T G T C T C T C A T G A A | + | | | G T C T C G G G G A G C G | | | | T T G G A G C T A G ATGTC C - G T - A T - A C - G G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |