Sequence ID | >WENV170705069 |
Genome ID | LLEP01000008 |
Phylum/Class | [LLEP] bioreactor metagenome; day64 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 142462 |
End posion on genome | 142538 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
ttctctttga |
tRNA gene sequence |
GGGGGTGTAGCTCAGTTGGTTAGAGCGCTGGCCTGTCACGCCAGAGGTCGCGGGTTCGAG |
Downstream region at tRNA end position |
cttttcctca |
Secondary structure (Cloverleaf model) | >WENV170705069 Asp GTC a GCCA cttttcctca G - C G - C G - C G + T G - C T - A G - C T G T T G C C C A T G A A + | | | | G T C T C G G C G G G C G | | | | T T G G A G C T T A G AGGTC C - G T - A G - C G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |