Sequence ID | >WENV170705070 |
Genome ID | LLEP01000009 |
Phylum/Class | [LLEP] bioreactor metagenome; day64 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 54332 |
End posion on genome | 54258 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
atcaaaatgt |
tRNA gene sequence |
GCCCGGGTAGCTCAGGGGTAGAGCAGCGGATTGAAAATCCGCGTGTCGGTGGTTCAAATC |
Downstream region at tRNA end position |
tgcctttcca |
Secondary structure (Cloverleaf model) | >WENV170705070 Phe GAA t ACCA tgcctttcca G - C C - G C - G C - G G - C G - C G - C T A T C C G C C A G A A | | + | | A G C T C G G G T G G C G | | | | T T G G A G C T A A GTGTC G - C C - G G - C G - C A - T T A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |