Sequence ID | >WENV170705072 |
Genome ID | LLEP01000011 |
Phylum/Class | [LLEP] bioreactor metagenome; day64 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 86542 |
End posion on genome | 86617 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
gctcccttta |
tRNA gene sequence |
GGGGCCTTAGCTCAGCTGGGAGAGCGCTTCGCTGGCAGCGAAGAGGTCAGCGGTTCGATC |
Downstream region at tRNA end position |
aactttcatt |
Secondary structure (Cloverleaf model) | >WENV170705072 Ala GGC a ACCA aactttcatt G - C G - C G + T G - C C - G C - G T - A C T T T C G C C A C G A A | | | | | G T C T C G A G C G G C G | | | | T T G G A G C G A G AGGTC C - G T - A T - A C - G G - C C G T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |