Sequence ID | >WENV170705076 |
Genome ID | LLEP01000017 |
Phylum/Class | [LLEP] bioreactor metagenome; day64 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 52603 |
End posion on genome | 52528 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
atgccctcaa |
tRNA gene sequence |
GCCGCTGTAGCTCAGTTGGTAGAGCACGTCATTCGTAATGATGGGGTCGTAGGTTCAAGT |
Downstream region at tRNA end position |
ttggcaaatg |
Secondary structure (Cloverleaf model) | >WENV170705076 Thr CGT a ACCA ttggcaaatg G - C C - G C - G G - C C - G T - A G - C T G T T A T C C A T G A A + | | | | A T C T C G G T A G G C G | | | | T T G G A G C T A A GGGTC C - G G + T T - A C - G A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |