Sequence ID | >WENV170705090 |
Genome ID | LLEP01000125 |
Phylum/Class | [LLEP] bioreactor metagenome; day64 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 1614 |
End posion on genome | 1689 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
tcgcttatgc |
tRNA gene sequence |
AGGGGTGTAGCTCAGTTGGTAGAGCATCGGTCTCCAAAACCGAGGGTCGTGAGTTCGAGT |
Downstream region at tRNA end position |
tttaaatcat |
Secondary structure (Cloverleaf model) | >WENV170705090 Trp CCA c GCCA tttaaatcat A - T G - C G - C G - C G - C T + G G - C T G T C T C T C A T G A A | | | | G T C T C G G T G A G C G | | | | T T G G A G C T A A GGGTC T - A C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |