Sequence ID | >WENV170705091 |
Genome ID | LLEP01000130 |
Phylum/Class | [LLEP] bioreactor metagenome; day64 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 1442 |
End posion on genome | 1516 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
ttgcacggat |
tRNA gene sequence |
GGGCGTATAGCTCAGCGGGAGAGCACTACATTGACATTGTAGGGGTCACTGGTTCAATCC |
Downstream region at tRNA end position |
tccaccctcc |
Secondary structure (Cloverleaf model) | >WENV170705091 Val GAC t ACCA tccaccctcc G - C G - C G - C C - G G - C T - A A - T C T T T G A C C A G A A | | | | | A C C T C G A C T G G C G | | | | T T G G A G C G A A GGGTC C - G T - A A - T C - G A - T T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |