Sequence ID | >WENV170705104 |
Genome ID | LLEP01001451 |
Phylum/Class | [LLEP] bioreactor metagenome; day64 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 1400 |
End posion on genome | 1474 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
ctagcaattt |
tRNA gene sequence |
GCTGCCGTAGCTCAGTGGTAGAGCACTCCATTGGTAATGGAGAGGTCGGGAGTTCGAGTC |
Downstream region at tRNA end position |
tttnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170705104 Thr GGT t ACCA tttnnnnnnn G - C C - G T - A G - C C - G C - G G - C T G T C C C T C A G A A | | | | | G T C T C G G G G A G C G | | | | T T G G A G C T A A AGGTC C - G T - A C - G C - G A - T T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |