Sequence ID | >WENV170705122 |
Genome ID | LLEP01003340 |
Phylum/Class | [LLEP] bioreactor metagenome; day64 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 811 |
End posion on genome | 722 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
cacagaattt |
tRNA gene sequence |
GGAGAGGTGCCAGAGTGGCCGAATGGGCTTGACTCGAAATCAAGTGACCCCTTGCGGGGT |
Downstream region at tRNA end position |
attaaccggg |
Secondary structure (Cloverleaf model) | >WENV170705122 Ser CGA t GCCA attaaccggg G - C G - C A - T G - C A - T G - C G - C T C T C A C C C A T G A G | | | | | G G G A C C G T G G G C G | | | T T C A T G G C G A G TGACCCCTTGCGGGGTCC C - G T - A T - A G - C A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |