Sequence ID | >WENV170705135 |
Genome ID | LLEP01005944 |
Phylum/Class | [LLEP] bioreactor metagenome; day64 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 434 |
End posion on genome | 348 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
gaccggaaaa |
tRNA gene sequence |
GCCGAGGTGGTGAAATTGGTAGACACGCTAGCTTCAGGTGCTAGTGGGGGCAACCCCGTG |
Downstream region at tRNA end position |
tacagaaccc |
Secondary structure (Cloverleaf model) | >WENV170705135 Leu CAG a ACCA tacagaaccc G - C C - G C - G G - C A - T G - C G - C T G T T C T C C A T A A G + | | | | A T A G T G G G A G G C G | | | T T G A C A C T A G G TGGGGGCAACCCCGT C - G T - A A - T G - C C - G T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |