Sequence ID | >WENV170705140 |
Genome ID | LLEP01006993 |
Phylum/Class | [LLEP] bioreactor metagenome; day64 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 321 |
End posion on genome | 405 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
gaataaatgt |
tRNA gene sequence |
GGAGGGGTGGGTGAGTGGTTAATACCACCAGACTGTAAATCTGGCGCCTTAGGCTACACT |
Downstream region at tRNA end position |
ttcaatgatt |
Secondary structure (Cloverleaf model) | >WENV170705140 Tyr GTA t ACCA ttcaatgatt G - C G - C A - T G - C G - C G - C G - C T A T T G A C C A T G A G | | | | | G G G T G G A C T G G C G + | | | T T T T A C C T A A A CGCCTTAGGCTAC C - G C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |