Sequence ID | >WENV170705142 |
Genome ID | LLEP01007350 |
Phylum/Class | [LLEP] bioreactor metagenome; day64 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 369 |
End posion on genome | 459 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
tcaaaattct |
tRNA gene sequence |
GGAGAGATGGCAGAGCGGTTGAATGCACTGGTCTTGAAAACCAGCGAGGGTTTGTAGCCC |
Downstream region at tRNA end position |
aataaaaagn |
Secondary structure (Cloverleaf model) | >WENV170705142 Ser TGA t GCCA aataaaaagn G - C G - C A - T G - C A - T G - C A - T T A T G T C C C A C G A G | | | | | G G G A C G C A G G G C G | | | T T T A T G C T G A A CGAGGGTTTGTAGCCCTCC C - G T - A G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |