Sequence ID | >WENV170705147 |
Genome ID | LLEP01008950 |
Phylum/Class | [LLEP] bioreactor metagenome; day64 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 285 |
End posion on genome | 371 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ctcttcatct |
tRNA gene sequence |
GCCGGGGTGGTGAAATTGGTAGACACAGGGGATTCAAAATCCCCCGGGGGCAACCCCTTG |
Downstream region at tRNA end position |
gtcacaagaa |
Secondary structure (Cloverleaf model) | >WENV170705147 Leu CAA t ACCA gtcacaagaa G + T C - G C - G G - C G + T G - C G - C T G T C A G C C A T A A G | | | | | G T A G T G G T C G G C G | | | T T G A C A C T A G A CGGGGGCAACCCCTT G - C G - C G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |