Sequence ID | >WENV170705153 |
Genome ID | LLEP01010750 |
Phylum/Class | [LLEP] bioreactor metagenome; day64 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 204 |
End posion on genome | 288 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
tcaccttagt |
tRNA gene sequence |
GCGGGTGTGGCGGAACTGGTAGACGCGCGGGATTCAAAATCCCGTTCCTTCGGGAGTGGG |
Downstream region at tRNA end position |
aacaaaaacc |
Secondary structure (Cloverleaf model) | >WENV170705153 Leu CAA t ACCA aacaaaaacc G - C C - G G - C G - C G - C T - A G - C T T T C T C C C A C A A G | + | | | G T G G C G G G G G G C G | | | T T G A C G C T A G G TTCCTTCGGGAGT C - G G - C G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |