Sequence ID | >WENV170705177 |
Genome ID | LLEQ01000034 |
Phylum/Class | [LLEQ] bioreactor metagenome; day86 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 2250 |
End posion on genome | 2333 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
cccgtcacag |
tRNA gene sequence |
TGGGCGACAGGCCGCAAGGTGTGGCAGGGGACTGTAACTCCCTCGCGGAGACGCACGCCT |
Downstream region at tRNA end position |
ttcttccaca |
Secondary structure (Cloverleaf model) | >WENV170705177 Tyr GTA g CCAc ttcttccaca T - A G - C G - C G - C C - G G - C A - T T T C G G A C C A A C G A | | | | | G A C C G G C C T G G C G | | T T G T G G C T G A CGCGGAGACGCACG G + T G - C G - C G - C A - T C C T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |