Sequence ID | >WENV170705181 |
Genome ID | LLEQ01000043 |
Phylum/Class | [LLEQ] bioreactor metagenome; day86 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 2196 |
End posion on genome | 2122 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
cattctttgc |
tRNA gene sequence |
AGGGGTGTAACTCAGTGGTAGAGTAGCGGACTCCAAACCCGCCTGCGGGGGGTTCGATTC |
Downstream region at tRNA end position |
gttttaccca |
Secondary structure (Cloverleaf model) | >WENV170705181 Trp CCA c GCCA gttttaccca A - T G + T G - C G - C G - C T - A G - C T T T C T C C C A G A A | + | | | G T C T C A G G G G G C G | | | | T T G G A G T T A A CTGCG G - C C - G G - C G - C A C C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |