Sequence ID | >WENV170705183 |
Genome ID | LLEQ01000043 |
Phylum/Class | [LLEQ] bioreactor metagenome; day86 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 1597 |
End posion on genome | 1512 |
Amino Acid | Leu |
Anticodon | AAG |
Upstream region at tRNA start position |
gtccgacgat |
tRNA gene sequence |
GCGGGTGTGGCGGAATGGTAGACGCACCAGATTAAGGTTCTGGCGAGGTTACACTCGTGG |
Downstream region at tRNA end position |
aaattccagg |
Secondary structure (Cloverleaf model) | >WENV170705183 Leu AAG t ACCA aaattccagg G - C C - G G - C G - C G - C T - A G - C T G T T C T C C A T A A G + | | | | A G G G C G G G A G G C G | | | T T T A C G C A G A CGAGGTTACACTCGT C - G C - G A - T G - C A - T T T T G A A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |