Sequence ID | >WENV170705184 |
Genome ID | LLEQ01000043 |
Phylum/Class | [LLEQ] bioreactor metagenome; day86 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 1485 |
End posion on genome | 1400 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
atttcctgat |
tRNA gene sequence |
GCCCATCTGGCGAAATGGTAGACGCGCCAGATTCAGGTTCTGGTATCCGAAAGGATGTTC |
Downstream region at tRNA end position |
actttccgcc |
Secondary structure (Cloverleaf model) | >WENV170705184 Leu CAG t ACCA actttccgcc G - C C - G C - G C - G A - T T + G C - G T C T A G C T C A T A A G | | | | | G G A G C G T C G A G C G | | | T T T A C G C A G G TATCCGAAAGGATGT C - G C - G A - T G - C A - T T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |