Sequence ID | >WENV170705196 |
Genome ID | LLEQ01000226 |
Phylum/Class | [LLEQ] bioreactor metagenome; day86 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 6477 |
End posion on genome | 6403 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
cacccctact |
tRNA gene sequence |
GCCTCTATTGTCCATGGGTTAAGATACCGGCCTGTCACGCCGTAGAATCGGGTTCAAGTC |
Downstream region at tRNA end position |
ataatttcca |
Secondary structure (Cloverleaf model) | >WENV170705196 Asp GTC t GCCA ataatttcca G - C C - G C - G T - A C - G T - A A - T T G T A G C C C A G T A T | | | | | A G C C T G T C G G G C G | | + T T T A G A T T A A AGAA C T C - G G - C G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |