Sequence ID | >WENV170705197 |
Genome ID | LLEQ01000226 |
Phylum/Class | [LLEQ] bioreactor metagenome; day86 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 6386 |
End posion on genome | 6299 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
tccagtccac |
tRNA gene sequence |
GCGGCCGTGGCGGAACTGGTATACGCGGCGGATTCAAAATCCGCTGGATTGATACTCCAT |
Downstream region at tRNA end position |
tttttttttg |
Secondary structure (Cloverleaf model) | >WENV170705197 Leu CAA c ACCA tttttttttg G - C C - G G - C G - C C - G C - G G - C G T T C G C C C A C A A G | | | | | G T G G C G G C G G G C G | | | T T G A C G C T A T G TGGATTGATACTCCAT G - C C - G G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |