Sequence ID | >WENV170705199 |
Genome ID | LLEQ01000226 |
Phylum/Class | [LLEQ] bioreactor metagenome; day86 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 6058 |
End posion on genome | 5983 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
gcccagccat |
tRNA gene sequence |
TCCCCGGTAGTTCAGTTGGTAGAACAACGGATTGTTAATCCGCATGTCGCCCGTTCGAGC |
Downstream region at tRNA end position |
gtaacatgca |
Secondary structure (Cloverleaf model) | >WENV170705199 Asn GTT t GCCA gtaacatgca T - A C - G C - G C - G C - G G - C G - C C G T C G G G C A T G A A | | | | | G T C T T G G C C C G C G | | | | T T G G A A C T A A ATGTC A C C - G G - C G - C A - T T A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |