Sequence ID | >WENV170705201 |
Genome ID | LLEQ01000226 |
Phylum/Class | [LLEQ] bioreactor metagenome; day86 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 5842 |
End posion on genome | 5751 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
attacacaca |
tRNA gene sequence |
GGAAGTGTGGCAGAGTGGTTTATTGCAGCGGATTTGAAATCCGCCGAACGGCTTGCGTCG |
Downstream region at tRNA end position |
cattccggcg |
Secondary structure (Cloverleaf model) | >WENV170705201 Ser TGA a GCCA cattccggcg G - C G - C A - T A - T G - C T - A G + T T A T T A C T C A T G A G | | | | | G G G A C G A T G A G C G + | | | T T T T T G C T T A A CGAACGGCTTGCGTCGTTCC G - C C - G G - C G - C A - T T A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |