Sequence ID | >WENV170705202 |
Genome ID | LLEQ01000226 |
Phylum/Class | [LLEQ] bioreactor metagenome; day86 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 5694 |
End posion on genome | 5620 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
cctccaccgg |
tRNA gene sequence |
GGCCGGCTGGCGGAATGGTGACGCACTGGATTGCAAACCCAGAACATGCCGGTTCGAGCC |
Downstream region at tRNA end position |
catatttcgc |
Secondary structure (Cloverleaf model) | >WENV170705202 Cys GCA g TCCA catatttcgc G - C G - C C - G C - G G - C G - C C - G C G T C G G C C A A A G | | | | | G T G G C G G C C G G C G | | | T T G A C G C T G A AACAT C - G T - A G - C G - C A C T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |