Sequence ID | >WENV170705204 |
Genome ID | LLEQ01000226 |
Phylum/Class | [LLEQ] bioreactor metagenome; day86 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 5526 |
End posion on genome | 5434 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
cataaccatc |
tRNA gene sequence |
GGATGAGTGGCAGAGTGGTTGAATGCACCGTCTTGGAAAGGCGGCAAAGGGGCGATCCCT |
Downstream region at tRNA end position |
aacagcaata |
Secondary structure (Cloverleaf model) | >WENV170705204 Ser GGA c GCCA aacagcaata G - C G - C A - T T - A G - C A - T G - C T A T C G C T C A T G A G | | | | | A G G A C G G C G A G C G | | | T T T A T G C T G A A CAAAGGGGCGATCCCTCTTTC C - G C - G G - C T + G C - G T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |