Sequence ID | >WENV170705208 |
Genome ID | LLEQ01000226 |
Phylum/Class | [LLEQ] bioreactor metagenome; day86 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 3908 |
End posion on genome | 3834 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
actgcttcac |
tRNA gene sequence |
GGGGCCTTAGCTCAGCGGTAGAGCGCTTCCTTCACACGGAAGATGTCGGAAGTTCGATCC |
Downstream region at tRNA end position |
aagaacgccg |
Secondary structure (Cloverleaf model) | >WENV170705208 Val CAC c ACCA aagaacgccg G - C G + T G - C G + T C - G C - G T - A C T T C C T T C A G A A | | | | | G C C T C G G G A A G C G | | | | T T G G A G C T A G ATGTC C - G T - A T - A C - G C - G T C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |