Sequence ID | >WENV170705209 |
Genome ID | LLEQ01000226 |
Phylum/Class | [LLEQ] bioreactor metagenome; day86 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 3772 |
End posion on genome | 3698 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
ccaaaataac |
tRNA gene sequence |
GGGACGTTAGCTCAGCGGTAGAGCGTCCGCTTGACATGCGGAAGGTCAATGGTTCAAGTC |
Downstream region at tRNA end position |
aaatttccga |
Secondary structure (Cloverleaf model) | >WENV170705209 Val GAC c ACCA aaatttccga G - C G - C G - C A A C - G G - C T - A T G T T T A C C A G A A | | | | | A C C T C G A A T G G C G | | | | T T G G A G C T A G AGGTC T - A C - G C - G G - C C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |