Sequence ID | >WENV170705210 |
Genome ID | LLEQ01000226 |
Phylum/Class | [LLEQ] bioreactor metagenome; day86 25degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 3689 |
End posion on genome | 3614 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
caaaatttcc |
tRNA gene sequence |
GAGGCCATAGCTCAGCCGGGAGAGCGCTTGCATGGCATGCAAGAGGTCGGGAGTTCGATC |
Downstream region at tRNA end position |
agaccttccg |
Secondary structure (Cloverleaf model) | >WENV170705210 Ala GGC c ACCA agaccttccg G - C A C G + T G - C C - G C - G A - T C T T C C C T C A C G A A | | | | | G C C T C G G G G A G C G | | | | T T G G A G C G A G AGGTC C - G T - A T - A G - C C - G A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |